🤖 BCH709 AI Assistant: Ask questions about this class using NotebookLM

BCH709 Introduction to Bioinformatics: 10_Genome assembly

Env setting

conda create -n preprocessing python=3 -y

conda activate preprocessing

conda install  -c r -c conda-forge -c anaconda -c bioconda  trim-galore jellyfish=2.2.10 'multiqc<1.34' nanostat nanoplot -y
conda create -n genomeassembly -y 
conda activate genomeassembly
conda install -c conda-forge -c anaconda -c bioconda spades canu pacbio_falcon samtools minimap2 'multiqc<1.34' assembly-stats openssl=1.0 -y
conda install  -c r -c conda-forge -c anaconda -c bioconda  r-ggplot2 r-stringr r-scales r-argparse -y

Genome assembly

Genome assembly

After DNA sequencing is complete, the fragments of DNA that come out of the machine are all jumbled up. Like a jigsaw puzzle we need to take the pieces of the genome and put them back together.

The human genome required a significant technological push

25✕ larger than any previously sequenced genome

  1. Construction of genetic and physical maps of human and mouse genomes
  2. Sequencing of yeast and worm genomes
  3. Pilot projects to test the feasibility and cost effectiveness of large-scale sequencing Genome assembly

human_genome

human_genome2

geneticmap

What’s the challenge?

assembly_depth

Coverage calculation

Example: I know that the genome size. I am sequencing 10 Mbases genome species. I want a 50x coverage to do a good assembly. I am ordering 125 bp Illumina reads. How many reads do I need?

De novo assembly

assembly_real.png

Genome assembly refers to the process of taking a large number of short DNA sequences and putting them back together to create a representation of the original chromosomes from which the DNA originated. De novo genome assemblies assume no prior knowledge of the source DNA sequence length, layout or composition. In a genome sequencing project, the DNA of the target organism is broken up into millions of small pieces and read on a sequencing machine. These “reads” vary from 20 to 1000 nucleotide base pairs (bp) in length depending on the sequencing method used. Typically for Illumina type short read sequencing, reads of length 36 - 150 bp are produced. These reads can be either single ended as described above or paired end. A good summary of other types of DNA sequencing can be found below.

Genome assembly

Paired end reads are produced when the fragment size used in the sequencing process is much longer (typically 250 - 500 bp long) and the ends of the fragment are read in towards the middle. This produces two “paired” reads. One from the left hand end of a fragment and one from the right with a known separation distance between them. (The known separation distance is actually a distribution with a mean and standard deviation as not all original fragments are of the same length.) This extra information contained in the paired end reads can be useful for helping to tie pieces of sequence together during the assembly process.

The goal of a sequence assembler is to produce long contiguous pieces of sequence (contigs) from these reads. The contigs are sometimes then ordered and oriented in relation to one another to form scaffolds. The distances between pairs of a set of paired end reads is useful information for this purpose.

The mechanisms used by assembly software are varied but the most common type for short reads is assembly by de Bruijn graph. See this document for an explanation of the de Bruijn graph genome assembler “SPAdes.”

Genome assembly is a very difficult computational problem, made more difficult because many genomes contain large numbers of identical sequences, known as repeats. These repeats can be thousands of nucleotides long, and some occur in thousands of different locations, especially in the large genomes of plants and animals.

Why do we want to assemble an organism’s DNA?

Determining the DNA sequence of an organism is useful in fundamental research into why and how they live, as well as in applied subjects. Because of the importance of DNA to living things, knowledge of a DNA sequence may be useful in practically any biological research. For example, in medicine it can be used to identify, diagnose and potentially develop treatments for genetic diseases. Similarly, research into pathogens may lead to treatments for contagious diseases.

What do we need to do?

The protocol in a nutshell:

Genome assembly

Flowchart of de novo assembly protocol.

Long read sequencing

Single Molecule, Real-Time (SMRT) Sequencing is the core technology powering our long-read sequencing platforms. This innovative approach was the first of its kind and is now a proven technology used in all fields of life science.

Long Reads (PacBio)

With reads tens of kilobases in length you can readily assemble complete genomes and sequence full-length transcripts.

pacbio A 20 kb size-selected human library using the SMRTbell Express Template Prep Kit 2.0 on a Sequel II System (2.0 Chemistry, Sequel II System Software v8.0, 30-hour movie).

SMRT Sequencing enables simultaneous collection of data from millions of wells using the natural process of DNA replication to sequence long fragments of native DNA or RNA.
pacbio

PacBio Error

pacbio hgap

Long Reads Assembly

longreads_assembly

OLC Algorithm

olc

OLC example

olc1
olc2 olc3

Long reads publications

Repeat in Genome

repeat repeat2 repeat3 repeat4 repeat5 repeat6 Fig: E.coli genome (4.6Mbp)

String Graph Algorithm

stringgraph

Hybrid Assembly

hybrid_assembly

Genome assembly complexity

GC-content

Secondary structure

Ploidy level

Size of organism

Pooled individuals

Inhibiting compounds

Presence of additional genomes/contamination

Heterozygosity

hetero

Haplotype

haplotype

Contiguity

Completeness : Total size

Proportion of the original genome represented by the assembly Can be between 0 and 1

size

Completeness: core genes

Correctness

Proportion of the assembly that is free from errors
Errors include

  1. Mis-joins
  2. Repeat compressions
  3. Unnecessary duplications
  4. Indels / SNPs caused by assembler

Optical mapping

bionano3 bionano2 bionano

10x Genomics

10x

Assembly results

assembly_results

Dotplot

genome_plot2 genome_plot

Metrics

N50

N50 N502

N50 example

Contig Length Cumulative Sum
100 100
200 300
230 530
400 930
750 1680
852 2532
950 3482
990 4472
1020 5492
1278 6770
1280 8050
1290 9340

Check Genome Size by Illumina Reads

cd /data/gpfs/assoc/bch709-1/<YOUR_ID>/
mkdir -p Genome_assembly/Illumina
cd Genome_assembly/Illumina

Create Preprocessing Env

conda create -n preprocessing python=3 -y

conda activate preprocessing

conda install -c bioconda trim-galore jellyfish=2.2.10 'multiqc<1.34' nanostat nanoplot -y

Reads Download

https://www.dropbox.com/s/ax38m9wra44lsgi/WGS_R1.fq.gz
https://www.dropbox.com/s/kp7et2du5c2v385/WGS_R2.fq.gz

Count Reads Number in file

echo $(zcat WGS_R1.fq.gz |wc -l)/4 | bc

echo $(cat WGS_R1.fq |wc -l)/4 | bc

Advanced approach

for i in `ls -1 *.fq.gz`; do echo $(zcat ${i} | wc -l)/4|bc; done


***For all gzip compressed fastq files, display the number of reads since 4 lines = 1 reads***

Reads Trimming

#!/bin/bash
#SBATCH --job-name=Trim
#SBATCH --cpus-per-task=8
#SBATCH --time=2:00:00
#SBATCH --mem=30g
#SBATCH --account=cpu-s2-bch709-1 
#SBATCH --partition=cpu-s2-core-0
#SBATCH --mail-type=all
#SBATCH --mail-user=<YOUR ID>@unr.edu

trim_galore --paired   --three_prime_clip_R1 10 --three_prime_clip_R2 10 --cores 8  --max_n 40  -o trimmed_fastq --fastqc <READ_R1> <READ_R2> 

multiqc . -n WGS_Illumina --exclude rsem --exclude gatk

Why assemble genomes

Assembly is very challenging (“impossible”) because

Prerequisite

Flow Cytometry

flowcytometry

K-mer spectrum

kmer2 genomescope

K-mer counting

mkdir kmer && cd kmer
#!/bin/bash
#SBATCH --job-name=Trim
#SBATCH --cpus-per-task=10
#SBATCH --time=2:00:00
#SBATCH --mem=10g
#SBATCH --account=cpu-s2-bch709-1 
#SBATCH --partition=cpu-s2-core-0
#SBATCH --mail-type=all
#SBATCH --mail-user=<YOUR ID>@unr.edu
#SBATCH -o trim.out # STDOUT
#SBATCH -e trim.err # STDERR
gunzip ../trimmed_fastq/*.gz
jellyfish count -C -m 21 -s 100000000 -t 10 ../trimmed_fastq/*.fq -o reads.jf
jellyfish histo -t 10 reads.jf > reads_jf.histo

Upload to GenomeScope

http://qb.cshl.edu/genomescope/genomescope2.0

Genome assembly Spades

cd /data/gpfs/assoc/bch709-1/<YOURID>/Genome_assembly/Illumina/
mkdir Spades
cd Spades
conda create -n genomeassembly -y 
conda activate genomeassembly
conda install -c bioconda spades canu pacbio_falcon samtools minimap2 'multiqc<1.34'  openssl=1.0 -y
conda install -c r r-ggplot2 r-stringr r-scales r-argparse -y

#!/bin/bash
#SBATCH --job-name=Spades
#SBATCH --cpus-per-task=32
#SBATCH --time=2:00:00
#SBATCH --mem=64g
#SBATCH --account=cpu-s2-bch709-1 
#SBATCH --partition=cpu-s2-core-0
#SBATCH --mail-type=all
#SBATCH --mail-user=<YOUR ID>@unr.edu
#SBATCH -o Spades.out # STDOUT
#SBATCH -e Spades.err # STDERR

spades.py -k 21,33,55,77 --careful -1 <trim_galore output> -2 <trim_galore output> -o spades_output --memory 64 --threads 32

###Spade spades spades2

Log

Command line: /data/gpfs/home/wyim/miniconda3/envs/genomeassembly/bin/spades.py -k21,33,55,77     --careful       -1      /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R1_val_1.fq.gz    -2      /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R2_val_2.fq.gz    -o      /data/gpfs/assoc/bch709-1/wyim/gee/spades_output       --memory        120     --threads       32

System information:
  SPAdes version: 3.13.1
  Python version: 3.7.3
  OS: Linux-3.10.0-957.27.2.el7.x86_64-x86_64-with-centos-7.6.1810-Core

Output dir: /data/gpfs/assoc/bch709-1/wyim/gee/spades_output
Mode: read error correction and assembling
Debug mode is turned OFF

Dataset parameters:
  Multi-cell mode (you should set '--sc' flag if input data was obtained with MDA (single-cell) technology or --meta flag if processing metagenomic dataset)
  Reads:
    Library number: 1, library type: paired-end
      orientation: fr
      left reads: ['/data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R1_val_1.fq.gz']
      right reads: ['/data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R2_val_2.fq.gz']
      interlaced reads: not specified
      single reads: not specified
      merged reads: not specified
Read error correction parameters:
  Iterations: 1
  PHRED offset will be auto-detected
  Corrected reads will be compressed
Assembly parameters:
  k: [21, 33, 55, 77]
  Repeat resolution is enabled
  Mismatch careful mode is turned ON
  MismatchCorrector will be used
  Coverage cutoff is turned OFF
Other parameters:
  Dir for temp files: /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/tmp
  Threads: 64
  Memory limit (in Gb): 140


======= SPAdes pipeline started. Log can be found here: /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/spades.log


===== Read error correction started.


== Running read error correction tool: /data/gpfs/home/wyim/miniconda3/envs/genomeassembly/bin/spades-hammer /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/corrected/configs/config.info

  0:00:00.000     4M / 4M    INFO    General                 (main.cpp                  :  75)   Starting BayesHammer, built from N/A, git revision N/A
  0:00:00.000     4M / 4M    INFO    General                 (main.cpp                  :  76)   Loading config from /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/corrected/configs/config.info
  0:00:00.001     4M / 4M    INFO    General                 (main.cpp                  :  78)   Maximum # of threads to use (adjusted due to OMP capabilities): 32
  0:00:00.001     4M / 4M    INFO    General                 (memory_limit.cpp          :  49)   Memory limit set to 140 Gb
  0:00:00.001     4M / 4M    INFO    General                 (main.cpp                  :  86)   Trying to determine PHRED offset
  0:00:00.038     4M / 4M    INFO    General                 (main.cpp                  :  92)   Determined value is 33
  0:00:00.038     4M / 4M    INFO    General                 (hammer_tools.cpp          :  36)   Hamming graph threshold tau=1, k=21, subkmer positions = [ 0 10 ]
  0:00:00.038     4M / 4M    INFO    General                 (main.cpp                  : 113)   Size of aux. kmer data 24 bytes
     === ITERATION 0 begins ===
  0:00:00.042     4M / 4M    INFO   K-mer Index Building     (kmer_index_builder.hpp    : 301)   Building kmer index
  0:00:00.042     4M / 4M    INFO    General                 (kmer_index_builder.hpp    : 117)   Splitting kmer instances into 512 files using 32 threads. This might take a while.
  0:00:00.043     4M / 4M    INFO    General                 (file_limit.hpp            :  32)   Open file limit set to 65536
  0:00:00.043     4M / 4M    INFO    General                 (kmer_splitters.hpp        :  89)   Memory available for splitting buffers: 1.45829 Gb
  0:00:00.043     4M / 4M    INFO    General                 (kmer_splitters.hpp        :  97)   Using cell size of 131072
  0:00:02.300    17G / 17G   INFO   K-mer Splitting          (kmer_data.cpp             :  97)   Processing /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R1_val_1.fq.gz
  0:00:19.373    17G / 18G   INFO   K-mer Splitting          (kmer_data.cpp             : 107)   Processed 3022711 reads
  0:00:19.373    17G / 18G   INFO   K-mer Splitting          (kmer_data.cpp             :  97)   Processing /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R2_val_2.fq.gz
  0:00:37.483    17G / 18G   INFO   K-mer Splitting          (kmer_data.cpp             : 107)   Processed 6045422 reads
  0:00:37.483    17G / 18G   INFO   K-mer Splitting          (kmer_data.cpp             : 112)   Total 6045422 reads processed
  0:00:39.173   128M / 18G   INFO    General                 (kmer_index_builder.hpp    : 120)   Starting k-mer counting.
  0:00:43.628   128M / 18G   INFO    General                 (kmer_index_builder.hpp    : 127)   K-mer counting done. There are 318799406 kmers in total.
  0:00:43.628   128M / 18G   INFO    General                 (kmer_index_builder.hpp    : 133)   Merging temporary buckets.
  0:00:48.548   128M / 18G   INFO   K-mer Index Building     (kmer_index_builder.hpp    : 314)   Building perfect hash indices
  0:00:58.437   320M / 18G   INFO    General                 (kmer_index_builder.hpp    : 150)   Merging final buckets.
  0:01:00.516   320M / 18G   INFO   K-mer Index Building     (kmer_index_builder.hpp    : 336)   Index built. Total 147835808 bytes occupied (3.70981 bits per kmer).
  0:01:00.518   320M / 18G   INFO   K-mer Counting           (kmer_data.cpp             : 356)   Arranging kmers in hash map order
  0:02:50.247     5G / 18G   INFO    General                 (main.cpp                  : 148)   Clustering Hamming graph.
  0:05:15.609     5G / 18G   INFO    General                 (main.cpp                  : 155)   Extracting clusters
  0:06:20.894     5G / 18G   INFO    General                 (main.cpp                  : 167)   Clustering done. Total clusters: 47999941
  0:06:20.900     2G / 18G   INFO   K-mer Counting           (kmer_data.cpp             : 376)   Collecting K-mer information, this takes a while.
  0:06:23.367     9G / 18G   INFO   K-mer Counting           (kmer_data.cpp             : 382)   Processing /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R1_val_1.fq.gz
  0:06:41.328     9G / 18G   INFO   K-mer Counting           (kmer_data.cpp             : 382)   Processing /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R2_val_2.fq.gz
  0:06:59.453     9G / 18G   INFO   K-mer Counting           (kmer_data.cpp             : 389)   Collection done, postprocessing.
  0:07:00.669     9G / 18G   INFO   K-mer Counting           (kmer_data.cpp             : 403)   There are 318799406 kmers in total. Among them 268145204 (84.1109%) are singletons.
  0:07:00.669     9G / 18G   INFO    General                 (main.cpp                  : 173)   Subclustering Hamming graph
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 649)   Subclustering done. Total 11739 non-read kmers were generated.
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 650)   Subclustering statistics:
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 651)     Total singleton hamming clusters: 31640728. Among them 6970 (0.0220286%) are good
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 652)     Total singleton subclusters: 14379. Among them 2710 (18.8469%) are good
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 653)     Total non-singleton subcluster centers: 20505272. Among them 19729791 (96.2181%) are good
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 654)     Average size of non-trivial subcluster: 14.0052 kmers
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 655)     Average number of sub-clusters per non-singleton cluster: 1.25432  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 656)     Total solid k-mers: 19739471
  0:15:33.177     9G / 18G   INFO   Hamming Subclustering    (kmer_cluster.cpp          : 657)     Substitution probabilities: [4,4]((0.944751,0.0179573,0.0182179,0.0190737),(0.0183827,0.9447,0.0178155,0.0191018),(0.0189441,0.0177016,0.94483,0.0185242),(0.0190054,0.0181679,0.0179184,0.944908))
  0:15:33.233     9G / 18G   INFO    General                 (main.cpp                  : 178)   Finished clustering.
  0:15:33.233     9G / 18G   INFO    General                 (main.cpp                  : 197)   Starting solid k-mers expansion in 32 threads.
  0:16:01.042     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 0 produced 1807215 new k-mers.
  0:16:28.728     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 1 produced 152036 new k-mers.
  0:16:56.455     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 2 produced 13249 new k-mers.
  0:17:24.110     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 3 produced 1204 new k-mers.
  0:17:51.837     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 4 produced 93 new k-mers.
  0:18:19.634     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 5 produced 20 new k-mers.
  0:18:47.540     9G / 18G   INFO    General                 (main.cpp                  : 218)   Solid k-mers iteration 6 produced 7 new k-mers.
  0:18:47.540     9G / 18G   INFO    General                 (main.cpp                  : 222)   Solid k-mers finalized
  0:18:47.540     9G / 18G   INFO    General                 (hammer_tools.cpp          : 220)   Starting read correction in 32 threads.
  0:18:47.540     9G / 18G   INFO    General                 (hammer_tools.cpp          : 233)   Correcting pair of reads: /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R1_val_1.fq.gz and /data/gpfs/assoc/bch709-1/wyim/gee/trimmed_fastq/WGS_R2_val_2.fq.gz
  0:19:07.696    12G / 18G   INFO    General                 (hammer_tools.cpp          : 168)   Prepared batch 0 of 3022711 reads.
  0:19:28.112    12G / 18G   INFO    General                 (hammer_tools.cpp          : 175)   Processed batch 0
  0:19:33.861    12G / 18G   INFO    General                 (hammer_tools.cpp          : 185)   Written batch 0
  0:19:35.020     9G / 18G   INFO    General                 (hammer_tools.cpp          : 274)   Correction done. Changed 10322067 bases in 4896755 reads.
  0:19:35.020     9G / 18G   INFO    General                 (hammer_tools.cpp          : 275)   Failed to correct 299 bases out of 782307432.
  0:19:35.053   128M / 18G   INFO    General                 (main.cpp                  : 255)   Saving corrected dataset description to /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/corrected/corrected.yaml
  0:19:35.054   128M / 18G   INFO    General                 (main.cpp                  : 262)   All done. Exiting.

== Compressing corrected reads (with pigz)

== Dataset description file was created: /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/corrected/corrected.yaml


===== Read error correction finished.


===== Assembling started.



===== Mismatch correction finished.

 * Corrected reads are in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/corrected/
 * Assembled contigs are in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/contigs.fasta
 * Assembled scaffolds are in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/scaffolds.fasta
 * Paths in the assembly graph corresponding to the contigs are in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/contigs.paths
 * Paths in the assembly graph corresponding to the scaffolds are in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/scaffolds.paths
 * Assembly graph is in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/assembly_graph.fastg
 * Assembly graph in GFA format is in /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/assembly_graph_with_scaffolds.gfa

======= SPAdes pipeline finished.

SPAdes log can be found here: /data/gpfs/assoc/bch709-1/wyim/gee/spades_output/spades.log

Thank you for using SPAdes!

Assembly statistics

N50 example

N50 is a measure to describe the quality of assembled genomes that are fragmented in contigs of different length. The N50 is defined as the minimum contig length needed to cover 50% of the genome.

Contig Length
100
200
230
400
750
852
950
990
1020
1278
1280
1290
conda install -c bioconda -c conda-forge assembly-stats
cd spades_output
assembly-stats scaffolds.fasta
assembly-stats contigs.fasta

Assembly statistics result

stats for scaffolds.fasta
sum = 11241648, n = 2345, ave = 4793.88, largest = 677246
N50 = 167555, n = 17
N60 = 124056, n = 24
N70 = 97565, n = 34
N80 = 72177, n = 48
N90 = 38001, n = 68
N100 = 78, n = 2345
N_count = 308
Gaps = 4
stats for contigs.fasta
sum = 11241391, n = 2349, ave = 4785.61, largest = 666314
N50 = 167555, n = 17
N60 = 123051, n = 25
N70 = 95026, n = 36
N80 = 70916, n = 50
N90 = 36771, n = 71
N100 = 78, n = 2349
N_count = 0
Gaps = 0
cat scaffolds.paths
NODE_1_length_677246_cov_27.741934
5330914+,39250+,5099246-;
4754344-,4601428-,5180688-,1424894+,5327688+,732820-,5237058-,5052460-,4723018+,4800852+,5331930-,732820-,5019006-,5052460-,4755300-,4800852+,5331932-,5060558+,5185654-,5071338-,5178452+,5178460+,5178468+,5178476+,5254862-,5325448+,88806-,5243982-,5053698+,1425522-,5239940+,5238056-,4867204-,5331654+
NODE_1_length_677246_cov_27.741934'
5331654-,4867204+,5238056+,5239940-,1425522+,5053698-,5243982+,88806+,5325448-,5254862+,5178476-,5178468-,5178460-,5178452-,5071338+,5185654+,5060558-,5331932+,4800852-,4755300+,5052460+,5019006+,732820+,5331930+,4800852-,4723018-,5052460+,5237058+,732820+,5327688-,1424894-,5180688+,4601428+,4754344+;
5099246+,39250-,5330914-
NODE_2_length_666314_cov_27.644287
5327204+,103640+,4836832-,4851626+,5361530-,5361524-,5361528-,5329856-,1126012-,5329854-,1126012-,5236812+,5052228+,5236810+,5052228+,5099424-,4479150+,4812968+,4479150+,5062132+,414588+,5051858+,414588+,5331378+,4760742-,4925978+,5327370-,474724-,5094420-,4653402-,5331664-,4961012-,5018412+,5072166+,5040312+,5030606-,4961012-,5236106+,5072166+,5072168+,4915570-,5050466-,4765966-,5059218-,4915570-,5058386-,5236104+,5095538-,5095540-,5095538-,5149466+,4774822-,5017666+,4774822-,5065186-,876886-,4799048-,876886-,5332178-
NODE_2_length_666314_cov_27.644287'
5332178+,876886+,4799048+,876886+,5065186+,4774822+,5017666-,4774822+,5149466-,5095538+,5095540+,5095538+,5236104-,5058386+,4915570+,5059218+,4765966+,5050466+,4915570+,5072168-,5072166-,5236106-,4961012+,5030606+,5040312-,5072166-,5018412-,4961012+,5331664+,4653402+,5094420+,474724+,5327370+,4925978-,4760742+,5331378-,414588-,5051858-,414588-,5062132-,4479150-,4812968-,4479150-,5099424+,5052228-,5236810-,5052228-,5236812-,1126012+,5329854+,1126012+,5329856+,5361528+,5361524+,5361530+,4851626-,4836832+,103640-,5327204-
NODE_3_length_613985_cov_27.733595
5250014-,5121298+,5057128-,4953418-,5238246+,5264238+,5264242+,4468126+,5331520+,4813546-,4676908-,4813546-,5059540-,4862238+,5032536-,4862238+,5045932+,1122610+,4827200-,928516+,5031788-,4629584+,5007546-,1271448+,4907228+,1271448+,5099418-,5331326-,5030236-,5236282-,5100426-,5100418-,5100430-,139162-,4675324-,5354642-,372-,374+,5044194+,5058512+,5325918+,4544022-,4816684-,427838+,5238146+,269904+,117192-
NODE_3_length_613985_cov_27.733595'
117192+,269904-,5238146-,427838-,4816684+,4544022+,5325918-,5058512-,5044194-,374-,372+,5354642+,4675324+,139162+,5100430+,5100418+,5100426+,5236282+,5030236+,5331326+,5099418+,1271448-,4907228-,1271448-,5007546+,4629584-,5031788+,928516-,4827200+,1122610-,5045932-,4862238-,5032536+,4862238-,5059540+,4813546+,4676908+,4813546+,5331520-,4468126-,5264242-,5264238-,5238246-,4953418+,5057128+,5121298-,5250014+
NODE_4_length_431556_cov_27.699452

FASTG file format

>EDGE_5360468_length_246_cov_13.568047:EDGE_5284398_length_327_cov_11.636000,EDGE_5354800_length_230_cov_14.470588';
GCTTCTTCTTGCTTCTCAAAGCTTTGTTGGTTTAGCCAAAGTCCAGATGAGTCTTTATCT
TTGTATCTTCTAACAAGGAAACACTACTTAGGCTTTTAGGATAAGCTTGCGGTTTAAGTT
TGTATACTCAATCATACACATGACATCAAGTCATATTCGACTCCAAAACACTAACCAAGC
TTCTTCTTGCACCTCAAAGCTTTGTTGGTTTAGCCAAAGTCCATATAAGTCTTTGTCTTT
GTATCT
>EDGE_5360470_length_161_cov_15.607143:EDGE_5332762_length_98_cov_43.619048';
GCTTCTTCTTGCTTCTCAAAGCTTTGTTGGTTTAGCCAAAGTCCAGATGAGTCTTTATCT
TTGTATCTTCTAACAAGAAAACACTACTTACGCTTTTAGGATAATGTTGCGGTTTAAGTT
CTTATACTCAATCATACACATGACATCAAGTCATATTCGAC
>EDGE_5354230_length_92_cov_267.066667':EDGE_5354222_length_86_cov_252.444444',EDGE_5355724_length_1189_cov_26.724820;
AAGCAAAGACTAAGTTTGGGGGAGTTGATAAGTGTGTATTTTGCATGTTTTGAGCATCCA
TTTGTCATCACTTTAGCATCATATCATCACTG
>EDGE_5344586_length_373_cov_22.574324:EDGE_5360654_length_82_cov_117.400000';
GCTAAAGTGATGACAAATGGATGCTCAAAACATGCAAAATACACACTTATCAACTCCCCC
AAACTTAGTCTTTGCTTAAGAACAAGCTGGAGGTGAGGTTTGAAAGCGGGGACTCAGAGC
CAAAGCAGCAGATAAACCAGATGAAATCAATGTCCAAGTTGATAGTTCTAAGTTGCGATA
TGATCGAATTCTACTCAAAAACGTTAGCCATGCCTTTTTATCAATCAATCCGACTCATAT
GCTCGACCTACACGTGTTTTCAAATCTACCAATCCCTTTAACATTCATTAGCTCTAGAAC
GTGAATCAAGCAATGCATCATCAATGAACTCATTTGGCTAAGGTAAAAGGTCAAGAGACA
AAGATGGTCCCTT
>EDGE_5354236_length_91_cov_242.857143:EDGE_5350728_length_80_cov_275.666667';
GCTAAAGTGATGACAAATGGATGCTCAAAACATGCAAAATACACACTTATCAACTCCCCC
AAACTTAGTCTTTGCTTGCCCTCAAGCAAAC

bandage assembly_spades

bandage

Assignment

Please upload Bandage output